Identification of a Novel 7-bp Deletion in the α-Globin Gene Cluster in One Chinese Family.

Deletional α-thalassemia is characterized by reduced hemoglobin A2 and involves the deletion of a few nucleotides, which is a rare hereditary disease. However, the detection of rare mutations using commonly used genetic tests is highly challenging. In the present study, next-generation sequencing (NGS) was used to identify a novel 7-bp deletion α-thalassemia in one individual from a Chinese family. Hematological parameters of the family members were determined using an automated cell counter, and hemoglobin electrophoresis was performed using a capillary electrophoresis system. Subsequently, NGS was performed on the genomic DNA of the patient and her family members. The 7-bp deletion (named Hb Honghe [HBA1: c.401_407delGCACCGT]) of α-thalassemia in the α-globin gene was confirmed using Sanger sequencing. The patient's father was also a heterozygous carrier of HBA1: c.401_407delGCACCGT deletion, but not her mother or sister. The application of the combined molecular approach is essential for the accurate diagnosis of rare thalassemia. This study reports a novel case of α- thalassemia. The characterization of the mutation might provide new insights into genetic counseling and accurate diagnosis of thalassemia.

Five novel globin gene mutations identified in five Chinese families by next-generation sequencing.

BACKGROUND: Thalassemia is one of the most common inherited diseases worldwide. This report presents three novel cases of α-thalassemia and two novel cases of ß-thalassemia caused by five different mutations in the globin gene. METHODS: Next-generation sequencing (NGS) was used to identify novel α- and ß-thalassemia in five individuals, which was confirmed by Sanger sequencing of the globin gene. Hematological parameters were determined by an automated cell counter, and hemoglobin electrophoresis was carried out by a capillary electrophoresis system, respectively. The isoelectric point (pI), molecular weight, and conservation for the mutations were described by the Internet software programs. The pathogenicity for globin mutations was analyzed by bioinformatics analysis and relative quantitative analysis. RESULTS: NGS revealed five novel cases of α- and ß-thalassemia: HBA2:c.245C>T, HBA2:c.95+11_95+34delCTCCCCTGCTCCGACCCGGGCTCC, HBA2:c.54delC, HBB:c.373C>A, and HBB:c.40G>A. The clinical implications of these mutations were described. Computational predictions were made for pI, amino acid conservation, and pathogenicity of the missense mutation. Relative quantitative data of the α-globin mRNA were analyzed. CONCLUSION: Five novel globin mutations were identified in the populations of China, and those mutations were analyzed to provide a mechanistic view for their pathogenicity. These analyzed results improve genetic diagnostics for thalassemia, which can improve screening programs for thalassemia and prenatal diagnosis for Chinese population.

Molecular epidemiology, pathogenicity, and structural analysis of haemoglobin variants in the Yunnan province population of Southwestern China.

Abnormal haemoglobin (Hb) variants result in the most commonly inherited disorders in humans worldwide. In this study, we investigated the molecular epidemiology characteristics of Hb variants, along with associated structural and functional predictions in the Yunnan province population of Southwestern China. A total of 41,933 subjects who sought haemoglobinopathy screening were included. Based on bioinformatics and structural analysis, as well as protein modeling, the pathogenesis and type of Hb genetic mutations were characterized. Among all individuals studied, 328 cases (0.78%) were confirmed as carriers of Hb variants, with 13 cases (0.03%) presenting α-globin variants, 313 (0.75%) ß-globin variants, and two δ-globin variants. A total of 19 different mutations were identified, including three novel mutations. In addition, 48 cases of ααCS mutations and 14 cases of Hb H or Hb Bart's were found. The isoelectric point, evolutionary conservation, and genotype-phenotype correlation for these mutations were predicted. Additionally, secondary and tertiary protein structure modeling were performed for three selected mutations. In conclusion, the prevalence of Hb variants in the Yunnan population is much higher than other regions of China. Complete characterization of these Hb variants is essential for generating a rational strategy to control the haemoglobinopathies in this region.

Analysis of deletional hereditary persistence of fetal hemoglobin/δß-thalassemia and δ-globin gene mutations in Southerwestern China.

BACKGROUND: Deletional hereditary persistence of fetal hemoglobin (HPFH)/δß-thalassemia and δ-thalassemia are rare inherited disorders which may complicate the diagnosis of ß-thalassemia. The aim of this study was to reveal the frequency of these two disorders in Southwestern China. METHODS: A total of 33,596 subjects were enrolled for deletional HPFH/δß-thalassemia, and positive individuals with high fetal hemoglobin (Hb F) level were diagnosed by multiplex ligation-dependent probe amplification (MLPA). A total of 17,834 subjects were analyzed for mutations in the δ-globin gene. Positive samples with low Hb A2 levels were confirmed by δ-globin gene sequencing. Furthermore, the pathogenicity and construction of a selected δ-globin mutation were analyzed. RESULTS: A total of 92 suspected cases with Hb F ≥5.0% were further characterized by MLPA. Eight different deletional HPFH/δß-thalassemia were observed at a frequency of 0.024%. In addition, 195 cases suspected to have a δ-globin gene mutation (Hb A2 ≤2.0%) were characterized by molecular analysis. δ-Globin gene mutation was found at a frequency of 0.49% in Yunnan. The pathogenicity and construction for a selected δ-globin mutation was predicted. CONCLUSION: Screening of these two disorders was analyzed in Southwestern China, which could define the molecular basis of these conditions in this population.

TSPY1 suppresses USP7-mediated p53 function and promotes spermatogonial proliferation.

Testis-specific protein Y-linked 1 (TSPY1) is expressed predominantly in adult human spermatogonia and functions in the process of spermatogenesis; however, our understanding of the underlying mechanism is limited. Here we observed that TSPY1, as an interacting partner of TSPY-like 5 (TSPYL5), enhanced the competitive binding of TSPYL5 to ubiquitin-specific peptidase 7 (USP7) in conjunction with p53. This activity, together with its promotion of TSPYL5 expression by acting as a transcription factor, resulted in increased p53 ubiquitylation. Moreover, TSPY1 could decrease the p53 level by inducing the degradation of ubiquitinated USP7. We demonstrated that the promotion of p53 degradation by TSPY1 influenced the activity of p53 target molecules (CDK1, p21, and BAX) to expedite the G2/M phase transition and decrease cell apoptosis, accelerating cell proliferation. Taken together, the observations reveal the significance of TSPY1 as a suppressor of USP7-mediated p53 function in inhibiting p53-dependent cell proliferation arrest. By simulating TSPY1 function in Tspy1-deficient spermatogonia derived from mouse testes, we found that TSPY1 could promote spermatogonial proliferation by decreasing the Usp7-modulated p53 level. The findings suggest an additional mechanism underlying the regulation of spermatogonial p53 function, indicating the significance of TSPY1 in germline homeostasis maintenance and the potential of TSPY1 in regulating human spermatogonial proliferation via the USP7-mediated p53 signaling pathway.

Copy number variation of functional RBMY1 is associated with sperm motility: an azoospermia factor-linked candidate for asthenozoospermia.

STUDY QUESTION: What is the influence of copy number variation (CNV) in functional RNA binding motif protein Y-linked family 1 (RBMY1) on spermatogenic phenotypes? SUMMARY ANSWER: The RBMY1 functional copy dosage is positively correlated with sperm motility, and dosage insufficiency is an independent risk factor for asthenozoospermia. WHAT IS KNOWN ALREADY: RBMY1, a multi-copy gene expressed exclusively in the adult testis, is one of the most important candidates for male infertility in the azoospermia factor (AZF) region of the Y-chromosome. RBMY1 encodes an RNA-binding protein that serves as a pre-mRNA splicing regulator during spermatogenesis, and male mice deficient in Rbmy are sterile. STUDY DESIGN, SIZE, DURATION: A total of 3127 adult males were recruited from 2009 to 2016; of this group, the dosage of RBMY1 functional copy were investigated in 486 fertile males. In the remaining 2641 males with known spermatogenesis status, 1070 Y-chromosome haplogroup (Y-hg) O3* or O3e carriers without chromosomal aberration or known AZF structure mutations responsible for spermatogenic impairment, including 506 men with normozoospermia and 564 men with oligozoospermia or/and asthenozoospermia, were screened, and the RBMY1 functional copy dosage and copy conversion were determined to explore their associations with sperm phenotypes. The correlation between RBMY1 dosage and its mRNA level or RBMY1 protein level and the correlation between sperm RBMY1 level and motility were analysed in 15 testis tissue samples and eight semen samples. Ten additional semen samples were used to confirm the subcellular localization of RBMY1 in individual sperm. PARTICIPANTS/MATERIALS, SETTING, METHODS: All the Han volunteers donating whole blood, semen and testis tissue were from southwest China. RBMY1 copy number, copy conversion, mRNA/protein amount and protein location in sperm were detected using the AccuCopy® assay method, paralog ratio test, quantitative PCR, western blotting and immunofluorescence staining methods, respectively. MAIN RESULTS AND THE ROLE OF CHANCE: This study identified Y-hg-independent CNV of functional RBMY1 in the enrolled population. A difference in the distribution of RBMY1 copy number was observed between the group with normal sperm motility and the group with asthenozoospermia. A positive correlation between the RBMY1 copy dosage and sperm motility was identified, and the males with fewer than six copies of RBMY1 showed an elevated risk for asthenozoospermia relative to those with six RBMY1 copies, the most common dosage in the population. The RBMY1 copy dosage was positively correlated with its mRNA and protein level in the testis. Sperm with high motility were found to carry more RBMY1 protein than those with relatively low motility. The RBMY1 protein was confirmed to predominantly localize in the neck and mid-piece region of sperm as well as the principal piece of the sperm tail. Our population study completes a chain of evidence suggesting that RBMY1 influences the susceptibility of males to asthenozoospermia by modulating sperm motility. LIMITATIONS REASONS FOR CAUTION: High sequence similarity between the RBMY1 functional copies and a large number of pseudogenes potentially reduces the accuracy of the copy number detection. The mechanism underlying the CNV in RBMY1 is still unclear, and the effect of the structural variations in the RBMY1 copy cluster on the copy dosage of other protein-coding genes located in the region cannot be excluded, which may potentially bias our observations. WIDER IMPLICATIONS OF THE FINDINGS: Asthenozoospermia is a multi-factor complex disease with a limited number of proven susceptibility genes. This study identified a novel genomic candidate independently contributing to the condition, enriching our understanding of the role of AZF-linked genes in male reproduction. Our finding provides insight into the physiological and pathological characteristics of RBMY1 in terms of sperm motility, supplies persuasive evidence of the significance of RBMY1 copy number analysis in the clinical counselling of male infertility resulting from asthenozoospermia. STUDY FUNDING/COMPETING INTEREST(S): This work was funded by the National Natural Science Foundation of China (Nos. 81370748 and 30971598). The authors have no conflicts of interest.

Epigenetic modifications promote the expression of the orphan nuclear receptor NR0B1 in human lung adenocarcinoma cells.

The ectopic activation of NR0B1 is involved in the development of some cancers. However, the regulatory mechanisms controlling NR0B1 expression are not well understood. Therefore, the epigenetic modifications promoting NR0B1 activation were examined in this study. NR0B1 protein was detected in cancerous tissues of more than 50% of human lung adenocarcinoma (ADCA) cases and tended to be expressed in low-differentiated cancerous tissues obtained from males. Nevertheless, NR0B1 activation in ADCA has not previously been correlated with DNA demethylation. NR0B1 expression was not detected in 293T cells, although it contains a hypomethylated NR0B1 promoter. Treating 293T cells with a histone deacetylase inhibitor increased acetylated histone H4 binding to the NR0B1 promoter and activated NR0B1 expression. In contrast, treatment with histone methylase inhibitors decreased the methylation of histones H3K9 and H3K27 and slightly induced NR0B1 transcription. Furthermore, the level of acetyl-histone H4 binding to the NR0B1 promoter increased, whereas the occupancy of H3K27me3 was lower in cancerous tissues than in non-cancerous tissues. Similar histone occupancies were confirmed in a comparison of cancerous tissues with strong, moderate and negative NR0B1 expression. In conclusion, this study shows that CpG methylation within the NR0B1 promoter is not involved in the in vivo regulation of NR0B1 expression, whereas the hyperacetylation of histone H4 and the unmethylation of histones H3K9 and H3K27, and their binding to the NR0B1 promoter results in decondensed euchromatin for NR0B1 activation.

[c.2381-3T>C mutation of DMD gene: a rare SNP without significant pathogenicity].

OBJECTIVE: To clarify the nature of a DMD splice acceptor mutation c.2381-3T>C. METHODS: Genomic DNA was extracted from 5 members of a family affected with DMD. For an obligatory carrier, after excluding gross deletion and duplication of the DMD gene with multiplex ligation-dependent probe amplification (MLPA) method, all coding and splice site sequences of the DMD gene were analyzed with Next Generation Sequencing followed by confirmation with targeted Sanger sequencing. Mutations of the carrier were detected in other 4 members. For the splice site mutation, mini-gene was constructed and expressed in vitro to detect the number of transcript and cDNA sequence. RESULTS: A known nonsense mutation (c.8038C>T, p.Arg2680Ter) was identified in the carrier, her sister and the mother. The rest 4 members, except for the mother from the first generation, have all carried the c.2381-3T>C mutation. The latter has been described as a splice site mutation to cause DMD. One of 135 male adults without DMD was also detected to have carried the c.2381-3T>C mutation. No additional transcript was produced by the mini-genes containing c.2381-3T>C mutation. CONCLUSION: The c.8038C>T（p.Arg2680Ter）mutation of DMD gene probably underlies the disease in this family. The presence of the c.2381-3T>C mutation in a asymptomatic male and a non-DMD male control, together with the normal in vitro expression of the mini-gene carrying the c.2381-3T>C, strongly suggested that the c.2381-3T>C mutation collected in the Human Gene Mutation Database is a rare SNP without significant pathogenicity.

Genome-wide Loci linked to non-obstructive azoospermia susceptibility may be independent of reduced sperm production in males with normozoospermia.

Non-obstructive azoospermia (NOA) is a complex, multifactorial disease. Recent genome-wide association studies (GWAS) have identified eight NOA susceptibility loci at genome-wide significance of P < 5.0 × 10(-8) in Han Chinese from southeastern, northern, and central China. To better understand the role of the variants in conferring NOA risk, we selected four GWAS loci (HLA-DRA rs3129878, PRMT6 rs12097821, SOX5 rs10842262, and PEX10 rs2477686) that were reported before 2014 to investigate their association with NOA and their potential effects on sperm production in 1177 Han males from southwest China, including 545 patients with idiopathic NOA and 632 controls with normozoospermia. The results confirmed that the HLA-DRA rs3129878 was an NOA susceptibility locus in the present population. Along with our data, meta-analyses supported the association of the four GWAS-linked loci with NOA, whereas an additive effect of the four loci on NOA susceptibility was not found. Interestingly, the normozoospermic males with the risk genotypes of rs12097821 and rs3129878 + rs10842262 + rs12097821 were observed to have higher total sperm counts relative to non-risk genotypes, suggesting that the risk alleles of the genetic loci may not be via impairing spermatogenic ability to express susceptibility to NOA. These findings may advance our understanding of the role of the NOA susceptibility loci, although the results need to be confirmed in larger samples.

[Genetic and clinical study of three Chinese pedigrees with Fabry disease].

OBJECTIVE: Fabry disease is a rare lysosome storage disease featuring X-linked recessive inheritance. The study was to explore potential mutations of alpha-galactosidase A (GLA) gene and their correlation with clinic manifestations in three Chinese pedigrees with Fabry disease. METHODS: All exons and flanking sequences of GLA gene were amplified with PCR. Potential mutations were detected with bidirectional DNA sequencing. Correlation between particular mutations and clinic features were analyzed. RESULTS: A unreported missense mutation, c.797A>C (D266A) in GLA exon 5 was identified in pedigree 1. Also in exon 5, a missense mutation c.644A>G (N215S) was found in pedigree 2. In pedigree 3, a nonsense mutation c.355C>T (Q119X) was found in exon 2. The c.797A>C mutation was not detected in 200 unrelated male controls. The probands of pedigrees 1 and 3 had presented mainly with skin damage and chronic renal insufficiency, whilst the proband of pedigree 2 had presented with hypertrophic cardiomyopathy. CONCLUSION: The unreported c.797A>C (D266A) mutation is the sixth missense type mutation of the 266th codon of GLA gene, and all other 5 missense mutations reported previously had been confirmed to be responsible for Fabry disease. The c.797A>C mutation, not found in 200 unrelated male controls, may be the causative mutation in pedigree 1. The c.644A>G and c.355C>T mutations were first detected in Chinese patients. Variable phenotypes of Fabry disease may be in part attributed to the natures of particular mutations of GLA gene.

Combined analysis of genome-wide-linked susceptibility loci to Kawasaki disease in Han Chinese.

Kawasaki disease (KD) is a dominant cause of acquired heart disease in children due to frequent complicating coronary artery lesions (CALs). Genome-wide association study and linkage analysis have recently identified 6 susceptibility loci at genome-wide significance of P < 5.0 × 10(-8) in subjects of Japanese, Taiwanese and European. In present study, we analysed the variants of 6 single nucleotide polymorphisms (SNPs) in the genetic loci to investigate their potential effect on KD susceptibility and outcomes in Han Chinese population. As a result, the risk alleles of rs1801274 and rs2254546 were observed significant effect on KD with higher frequencies in 358 patients than those in 815 controls. The significant role of rs1801274, rs2857151 and rs2254546 in KD was found in the multi-variable logistic regression analysis of the SNPs. Two 2-locus and one 3-locus combinations of the SNPs showed significant effect on KD with stronger association with KD relative to comparable single SNP or 2-locus combinations. Significant susceptibility to CALs was found in KD patients with high-risk genotypes at both rs1801274 and rs2857151. The meta-analyses first revealed significant risk for CALs in KD patients carrying risk allele of rs11340705, and the association of rs28493229 with KD was not observed in the Han Chinese. In conclusion, the findings demonstrated that 5 of the 6 genetic loci influence the risk for KD and 3 of them may be involved in secondary CALs formation in Han Chinese. The additive effects of 3 multi-locus combinations on KD/CALs imply that some loci may participate together in certain unknown gene networks related to KD/CALs. Further function studies of the genetic loci are helpful for better understanding the pathophysiology of KD.

A significant effect of the TSPY1 copy number on spermatogenesis efficiency and the phenotypic expression of the gr/gr deletion.

AZFc deletions cause a significant phenotypic heterogeneity with respect to spermatogenesis; however, the reason for this is poorly understood. Recently, testis-specific protein Y-encoded 1 (TSPY1) copy number variation (CNV) was determined to be a potential genetic modifier of spermatogenesis. We performed a large-scale cohort study to investigate the effect of TSPY1 CNV on spermatogenesis and to elucidate the possible contribution of TSPY1 genetic variation to the phenotypic expression of AZFc deletions. Haplogrouping of the Y-chromosome and quantification of the TSPY1 copy number were performed in 2272 Han Chinese males with different spermatogenic statuses (704 males with the b2/b4 or gr/gr deletion and 1568 non-AZFc-deleted males). Our data revealed that the TSPY1 copy number distributions were significantly different among non-AZFc-deleted males with different spermatogenic phenotypes. Lower sperm production and an elevated risk of spermatogenic failure were observed in males with fewer than 21 TSPY1 copies and in those with more than 55 copies relative to men with 21-35 copies. Similar results were observed in males with the gr/gr deletion. These findings indicate that TSPY1 CNV affects an individual's susceptibility to spermatogenic failure by modulating the efficiency of spermatogenesis and strongly suggest that there is a significant quantity effect of the TSPY1 copy number on the phenotypic expression of the gr/gr deletion. To our knowledge, this CNV is the first independent genetic factor that has been clearly observed to influence the spermatogenic status of gr/gr deletion carriers. A combined genetic analysis of the TSPY1 copy number and the gr/gr deletion could inform the clinical counselling of infertile couples.